GRIFFIN TUCKER, GREAT HOUSE SCION, REBORN LVL 1
MOUNT DISCOVERY, PROVINCE OF ARAGONIA
Planetary System Analysis: Welcome to Nolm!
Planetary System Analysis: New user found
Planetary System Analysis: … |
Planetary System Analysis: … \
Planetary System Analysis: … -
Planetary System Analysis: … |
Planetary System Analysis: Execute DNA Scan to determine origin…
DNA Scan Beginning
DNA Scan 34% Complete
DNA Scan /
DNA Scan |
DNA Scan 100% Complete – GCCTTGGTACGATGATTTCGCCCCCGGATTCGTTTATAAAAAGCCAGGTCATCTTATTTTAAGGGATCCCTGGCGCGGGCAAATCTCTCTCTTGGGTTTATTAAACCCAGAGGAGATAGGTGTTTCTCCCTTTAAGGTCATTACCCATAGATACGATAGGTATCGGCTATATGCTTGATCGGCTAGATATATATACGAAAAATGGGGAACCCCCAACTTATATTTTGGTTTGTGTTTTTGGGCGCCGCGCCCGGCCCACACCAAAATTTATTATAGGGCTCCTCCTCT… Human genome detected.
Planetary System Analysis: Combination extranolmic and nolmic DNA origin.
Planetary System Analysis: Determine Reborn status…
Planetary System Analysis: Etherheart detected. Shift to SYSTEM interface.
SYSTEM: New Reborn has joined Nolm! You’re from quite a distance away it seems! Let’s see who you are… Let’s run a SCAN.
INTRUSIVE SCAN Progress … 3% Error 804
Name: Griffin Tucker
Err – 804 – Invalid NAME
SYSTEM: An error already? Why is the name invalid? Oh. Oh, interesting. That’s choice DNA in you there, “Griffin Tucker”. Since when did a Great House travel so far? Let’s correct the error and run the SCAN again.
INTRUSIVE SCAN Progress … 100%
Name: Griffin Tekara
House: Vasilias
Note: House Tekara was incorporated into Vasilias in 6E-5GA-IR 16988.
Rank: Unranked Reborn
Current status: Unconscious
SYSTEM: A scion of House Vasilias with all the genetic tags of a direct-line descendent. That’s a hefty System package. Let’s see what that comes with nowadays…
GREAT HOUSE SYSTEM PACKAGE
MONSTER SCAN ACCESS: Y
INVENTORY INTERFACE: Y (GREAT HOUSE BENEFIT)
INVENTORY SIZE: UNLIMITED (GREAT HOUSE BENEFIT)
SYSTEM INTERFACE TYPE: EIDOLON (SPECIFIED BY ETHERHEART)
AREA MAP ACCESS: HOUSE VASILIAS MAP PACKAGE (GREAT HOUSE BENEFIT)
LINGUISTICS: EXTENDED LINGUISTICS PACKAGE (GREAT HOUSE BENEFIT)
PERSONAL ACCOUNT: 0 VIL
CREDIT STATUS: GREAT HOUSE
SYSTEM: It’s been a long time since anyone has bothered to specify SYSTEM access in the enchantments bound up in the etherheart. Very elegant; too bad it fell out of style. And a SYSTEM EIDOLON… How many of those are even out there anymore?
SELF-QUERY: call COUNT param SYS_ACC,eidolon,ACTIVE,NOTDEAD
SELF-QUERY: COUNT = 37
SYSTEM: Wow, less than fifty! They fell out of style when House Ulthus finally released the neurocannular implant but it’s always nice to see someone respecting the classics. This guy is going to need it too. With his origins, he’ll need all the help he can get. Better get to work!
SYSTEM: Creating eidolon package
SYSTEM: Great House upgrade in place
SYSTEM: Analyzing brain waves… 100% Personality analysis: Complete. Contextualizing… Err 9911 NO CONTEXT. MEM_CONTEXT.integration subroutine initialized. 22%... Initializing memory_read… Complete. Calculating cultural signifiers… |
SYSTEM: /
SYSTEM: -
SYSTEM: Cultural signifiers calculated. Constructing eidolon personality framework. Complete. Anima integration ritual initiated. Integration ritual estimated time to completion… 3 h 44 m.
5 HOURS LATER
Achievement Gained!
Void Apocalypse Survivor
Description: You survived the Herald’s Message Void effect. You survived the destruction of your homeworld. Congratulations.
Reward: New Classes unlocked at Stone Rank
Screeeeeeeeeeeeeeeeeeeeeeeech. Griffin winced as the sound cut through his sleep with all the gentle melody of a dentist’s drill. His chest hurt. Bad. And he was cold. He reached up to his chest and felt a tight, thick bandage there. His brain felt… fizzy. Electric. His eyes popped open, and he rolled over, reaching for blankets that weren’t there.
You might be reading a stolen copy. Visit Royal Road for the authentic version.
Instead of rolling onto more bed, he fell off the gurney. He was no longer restrained, though he was still naked save for the bandage. He had fallen out of the gurney onto a dirty tile floor. It was dimly lit from above by…not lightbulbs. Panels? Some kind of LED? He grabbed the gurney and lifted himself up, expecting to feel more pain.
Instead, there was a text box floating in front of his face. The box was outlined in shimmering purple lines and the words appeared to be in a language he’d never seen before. A moment later, the odd characters seemed to shiver and then resolve into English characters.
Griffin blinked, startled by the sudden change. He read the message, and the box disappeared as soon as he did. Achievement gained? He thought. What the hell does that description mean?! Did that mean that August hadn’t been lying?
Is the Earth…gone? He tried imagining it. The Earth suddenly a slowly cooling bunch of rock and ice spinning through the cold uncaring void of space. But that was too big a thought for him to comprehend. He shuddered at the thought, mentally backing away from thinking about it now.
Wait, he said he’d be doing major surgery on me. Did he actually…do it? He shuddered as he remembered the otherworldly sharpness of the odd crystalline shards August had waved in front of him. But he didn’t feel like he’d just been cut open and stitched back together. I don’t feel like I’ve been operated on but maybe that’s just incredibly good drugs.
He was surprised when he didn’t feel any pain at all. He felt sharp and clear-headed; ready to respond to just about anything. Griffin stood up from the dirty floor and surveyed the room he was in. It was another hospital room. At least, that’s what he immediately thought of. Or maybe it was a hotel room? Whatever it was, it was ruined.
Griffin tried to remember exactly what else the text box had said. Something about…Classes? He thought. The implications were almost as mind-boggling as the Earth being gone.
Nope, still can’t get my mind around it, he thought. The implications of Classes are almost as mind-boggling as…SysLogic and all my cases—Evan, Casey, the rest of the team—all being gone. He found that his brain could handle that thought without rejecting it outright. He shifted his attention to the strange place he’d found himself in.
The room was filthy with dirt and debris and looked like it was old and run-down. Other than the hospital gurney he’d fallen out of, there was a twin-sized bed with a mattress that looked like it had an enormous hole chewed into it. The hole was dark and glistened with some kind of dark, wet substance. The bed was stained brown and black, crusted with filth. There was the wreckage of what might have been a set of drawers against the opposite wall, just about two meters away from the bed. It was a small hotel room. It smelled like ass in here.
He felt the bandage around his chest hesitantly again, expecting to feel another stab of pain. But there was nothing: no soreness, no bleeding, nothing at all. Weird… He looked around him, trying to see if there was a way out. He spotted a door at the far end of the room. It looked like the door had also mostly collapsed, though it was now propped closed by some kind of heavy metal table like a lab table from his old high school classroom. The gurney he had fallen off of was shoved into the furthest corner of the room away from the door. He was just a couple of meters away from the bed though.
A heavy footlocker was lying on the ground next to the collapsed door with its contents spread all over the place. Griffin rushed over, trying to see if there were any clothes ignoring those weird shard things in the black box that August had given him. No, no clothes. He picked up a tablet, poking at the screen for a moment before he stopped, eyes going wide. He remembered that Sarah had been with him but…no she wasn’t here.
“Sarah?!” he called out and waited for several seconds. No answer. Where was she?! “Sarah!” He shouted again, as loud as he could.
There was a heavy clunk from near the door. Griffin looked over towards the door and found a huge dark brown mandible or some other kind of spiky, chitinous appendage poking through the gap in the door and the metal table leaning against the wreckage. He held up the tablet reflexively like a shield as he screamed in terror at the gruesome sight. The appendage flexed and screeeeeeeeeeched across the tile floor again and Griffin just stood there with a shocked look on his face.
“Griffin,” Sarah’s voice said right in his ear.
He screamed again and jumped, spinning around and looking all over for her. She was not there. “I’m not actually Sarah, Griffin,” Sarah said. A tiny version of Sarah appeared standing on the gurney. She looked just like she had when they’d left for Chinese food a little while ago, but maybe four inches tall. He felt a sudden, sharp disconnect from reality and it hit him with an almost physical sensation. Tiny Sarah repeated herself, “I’m not Sarah.”
Clunk. “Who, uh, are you? And where is Sarah?!” Griffin asked, jumping as the huge spiky appendage reached through the gap in the door again. Screeeeeeeeeeeeeeeeeeeeech. “And what in the every-loving-Hell is that?!” The leg retracted from the gap between the broken door and the leaning table.
“My name is Kismet,” the tiny Sarah said, one tiny hand on her chest, her other hand pointed at the door. “That is a plasma cybercentipede. And there is no one named Sarah here. You’re the first living person to set foot here in some ten thousand years! There’s a lot to unpack here, but you have more immediate concerns.” Kismet pointed over to the wrecked door. “The plasma cybercentipede looks to have figured out how to open the door.”
The door shuddered as something slammed into it. The metal table leaning against the door bucked and fell to the side, still wedged against the doorway but even more precariously than before. Another good hit like the first would buckle the door in.
“What should I do?!” Griffin moaned, whipping his head around in a panic. He was torn between holding the door and being frozen in terror. Suddenly, another holographic text box popped up in front of him, startling him out of his terror for a moment.
System Message
New Quest Alert! Your First Quest
Destroy the Plasma Cybercentipede Infestation!
Plasma cybercentipede Mothers have infested House Vasilias’ secret lab for more than a thousand years. Destroy the Mothers and clear out the infestation.
Reward: 1 x Rare ethershard
Achievement: Mechanized Myriapod Matron Massacre
Accept?
Yes / No
Unlike the first text box, this one was outlined in shimmering golden lines and it was already in English. He thought, Accept the Quest? What the hell does that— As soon as he thought ‘Accept’, the text box disappeared.
Tiny Sarah—Kismet—said, “Ooh! You have a Quest—and a gold one, too! Oh. That’s odd,” she seemed to get a faraway look in her eyes and Griffin stared at her uncomprehendingly. “There really shouldn’t be any plasma cybercentipedes here, that explains the high-rarity Quest quality for such a relatively simple task.”
She looked far away for a second or two before she smiled and said, “I’ve updated the System map and monster bestiary accordingly,” she said. “This really is excellent! Even if our association is short—and I’m afraid it looks like it’s going to be—you’ve already proved an invaluable service.”
“What?!” Griffin said again.
“I’ve updated the local maps,” Kismet replied. “Your Quest says that you need to destroy the Plasma Cybercentipede Mother which infests the heart of this place with her million-strong brood.”
“A plasma cyber-what?!” Griffin screamed.
She nodded with a commiserating expression on her face, “I know! This area is only supposed to have giant centipedes! A little unfortunate for you: newly Reborn do like to practice their new grafts and abilities on the weakest monsters.” Kismet looked significantly at the door. “Plasma cybercentipedes on the other hand… Well. Those are high Class 1 monsters—almost Class 2—and if there’s a Mother in here, then that’s at least an elite, maybe even a Boss. Unless you’re hiding expert training or a variety of super bomb, I think your chances of survival are…rather low.”
The metal table shot across the room, clipping Griffin’s hip as it slammed into the wall. He cried out in pain as he fell from the impact. The doorway was wide open now and filling it was a terrifying nightmare monstrosity. Gripping the doorway with half a dozen chitinous legs, the plasma cybercentipede’s largest eye was still glowing white-hot from the plasma blast it had used to open the door.
Its mandibles stretched wide and clattered metallically as its mouthpieces scissored open and closed. It chittered in a high-pitched squeal and fixed its eye on Griffin.
“You do have a graft,” Kismet said conversationally, “but it’s an unusual one. I doubt it’ll be much use right now. It seems to be a utility power more than anything else.”
“Auuuuugh!” Griffin screamed in response, still on the floor. He was holding the strange tablet he’d grabbed from the pile on the floor over his genitals, desperate to keep the nightmare away from him. The plasma cybercentipede crawled into the room, clinging to the ceiling. The thing was as big around as a large dog, but much longer. It was dark brown and glistening with some kind of secretion. Strange circuitry and LEDs glowed along its segmented body and blue sparks arced from body segment to body segment like a web of lightning. “It’s going to kill me!”
Kismet nodded sadly, “It does appear that way.” The plasma Cybercentipede paused in its inexorable serpentine crawl across the ceiling. Its large red eye began to glow white hot. “You might have a chance if you go through the bed though.”
Griffin remembered that the bed looked like it had been eaten through or something. He glanced up at the ceiling and the cybernetic monster’s eye was glowing a baleful whiteish-red with green slime dripping from its mouthparts as its mandibles gnashed in gruesome chittering noises. Griffin scrambled to his feet, keeping his head covered with his arms as he clutched the tablet, he ran naked to the bed. He jumped into the filth-encrusted hole in the mattress with no real plan or hope just as he felt a flash of intense heat on his naked thighs and calves.
“Aaaaaaaaauuuuugh!” He screamed as he fell through the hole in the mattress. He discovered that the hole in the mattress did not in fact lead to the floor. There was a slime-and-filth-encrusted hole in the floor that led to a disturbingly biological feeling tunnel. It was warm and dark and wet as he slid down the tunnel. It smelled like rotten meat.
The tunnel emptied into a large dark room. He fell maybe twenty feet, screaming the entire way until he landed on something very soft that squelched and burst apart underneath him. The wind was knocked out of him, and he lay on his back feeling battered and bruised, gasping like a fish out of water. Kismet appeared on his chest, looking down at him, her face twisted with a critical grimace. Griffin noticed that even though she was standing right on him, she didn’t weigh anything at all.
“That was abysmal. You screamed the whole way down. At least you held onto that Systablo, so you’re not completely hopeless.” She crossed her arms and shook her head sadly. “Why don’t you try using your graft like I suggested the first time? It’s called Adaptive Conjuration. It has limited combat use, but imaginatively applied, I can see a few ways you might ameliorate your current situation.”